Logo image
RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis (vol 49, pg 2005, 2021)
Journal article   Open access   Peer reviewed

RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis (vol 49, pg 2005, 2021)

Adam Hefel, Masayoshi Honda, Nicholas Cronin, Kailey Harrell, Pooja Patel, Maria Spies and Sarit Smolikove
Nucleic acids research, Vol.49(15), pp.9003-9003
09/07/2021
DOI: 10.1093/nar/gkab631
PMCID: PMC8421208
PMID: 34370030
url
https://doi.org/10.1093/nar/gkab631View
Published (Version of record) Open Access

Abstract

The authors wish to introduce the following corrections to their article (1). 1) The DNA sequence for the OLLAS::RPA-1 is incorrect. The correct sequence is: TTCCCCAATTTTTATGTATCTGTTTCAGATAGTGAAAGATGTCCGGATTCGCCAACGAGCTCGGACCACG TCTCATGGGAAAGGCGGCAATTCACATCAATCACGATGTCTTCAATAA 2) In some places in the list of Strains rpa-1 was indicated to be placed on chromosome I, when its correct position is on chromosome II. The published article has been updated. These changes do not affect the results, discussion and conclusions presented in the article.
Biochemistry & Molecular Biology Life Sciences & Biomedicine Science & Technology

Details

Metrics

13 Record Views
Logo image