Journal article
RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis (vol 49, pg 2005, 2021)
Nucleic acids research, Vol.49(15), pp.9003-9003
09/07/2021
DOI: 10.1093/nar/gkab631
PMCID: PMC8421208
PMID: 34370030
Abstract
The authors wish to introduce the following corrections to their article (1). 1) The DNA sequence for the OLLAS::RPA-1 is incorrect. The correct sequence is: TTCCCCAATTTTTATGTATCTGTTTCAGATAGTGAAAGATGTCCGGATTCGCCAACGAGCTCGGACCACG TCTCATGGGAAAGGCGGCAATTCACATCAATCACGATGTCTTCAATAA 2) In some places in the list of Strains rpa-1 was indicated to be placed on chromosome I, when its correct position is on chromosome II. The published article has been updated. These changes do not affect the results, discussion and conclusions presented in the article.
Details
- Title: Subtitle
- RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis (vol 49, pg 2005, 2021)
- Creators
- Adam Hefel - University of IowaMasayoshi Honda - Roy J. and Lucille A. Carver College of MedicineNicholas Cronin - Roy J. and Lucille A. Carver College of MedicineKailey Harrell - University of IowaPooja Patel - University of IowaMaria Spies - Roy J. and Lucille A. Carver College of MedicineSarit Smolikove - University of Iowa
- Resource Type
- Journal article
- Publication Details
- Nucleic acids research, Vol.49(15), pp.9003-9003
- DOI
- 10.1093/nar/gkab631
- PMID
- 34370030
- PMCID
- PMC8421208
- NLM abbreviation
- Nucleic Acids Res
- ISSN
- 0305-1048
- eISSN
- 1362-4962
- Publisher
- Oxford Univ Press
- Number of pages
- 1
- Language
- English
- Date published
- 09/07/2021
- Academic Unit
- Orthopedics and Rehabilitation; Biology; Radiation Oncology; Biochemistry and Molecular Biology
- Record Identifier
- 9984288730002771
Metrics
13 Record Views